Eblablogo

The Environmental Biotechnology Lab

Corrigendum to “Kinetics and mechanism of plasmid DNA penetration through nanopores” [J. Membr. Sci. 371 (2011) 45–51](S0376738811000196)(10.1016/j.memsci.2011.01.014)

Elizabeth Arkhangelsky, Yossi Sefi, Barak Hajaj, Gadi Rothenberg, Eitan Ben-Dov, Ariel Kushmaro,Vitaly Gitis

The authors would like to apologize for the incorrect information on primers used in the amplification of pGEMR plasmid in the PCR methodology as published in ‘Kinetics and mechanism of plasmid DNA penetration through nanopores’. The correct procedure is shown below. 2.5. Procedure for qualitative analysis using conventional PCR amplification A 439 bp fragment of pHE4-ADR plasmid (9.5 kb), before and after filtration through PES membrane was amplified using Un4(d) GCATATGATGTAGCGAAACAAGCC and Un4(r) GCGTGACATACCCATTTCCAGGTCC primers, with a Mastercycler gradient thermocycler (Eppendorf, Westbury, N.Y.). Reaction mixtures included a 12.5 µl ReddyMix (PCR Master mix containing 1.5 mM MgCl2 and 0.2 mM concentration of each deoxynucleoside triphosphate), 1 pmol of each of the forward and reverse primers, 1–2 µl of the sample preparation, plus water to bring the total volume to 25 µl. An initial denaturation-hot start of 2 min at 94 °C was followed by 30 cycles of the following incubation pattern: 94 °C for 30 s, 54 °C for 30 s, and 72 °C for 45 s. The PCR products were purified by electrophoresis through a 0.8% agarose gel, stained with ethidium bromide and visualized on a UV transilluminator. The O'GeneRuler™ 1 kb DNA ladder, 250–10,000 bp (Thermo Fisher Scientific) was used. 2.6. Procedure for quantitative analysis using real-time PCR The concentration of pHE4-ADR plasmid (9.5 kb) plasmid in feed and permeate fractions were determined by real-time PCR using the following sets of primers: Un4(d) GCATATGATGTAGCGAAACAAGCC and Un4-r(2) CTCAGCGTACTGAATTTGAGCG, Un4-d(2) GCGTATCTCAAAATGTCCATCTCC and Un4(r) GCGTGACATACCCATTTCCAGGTCC. Pair of primers: 341F CCTACGGGAGGCAGCAG and 518R ATTACCGCGGCTGCTGG were used for amplifying the pGEMR plasmid (4.5 kb). Quantification of bacterial DNA was performed in the ABI prism 7000 Sequence Detection System using Absolute QPCR SYBR Green ROX Mix on a 96-well optical plate. The PCR reaction consisted of 10 µl of Absolute QPCR SYBR Green ROX Mix, 150 nM each of forward and reverse primers, and 5.0 µl of each DNA template, in a total volume of 20 µl. Thermal cycling conditions were as follows: 2 min at 50 °C, 15 min at 95 °C, followed by 40 rounds of 15 s at 95 °C and 1 min at 60 °C. To verify that the used primer pair produced only a single specific product, a dissociation protocol was added after thermocycling, to determine dissociation of the PCR products from 60 °C to 95 °C. The ABI prism 7000 Sequence Detection System and SDS Software were used for data analysis. The ABI prism 7000 monitors the fluorescence resonance energy transfer (with a SYBR Green fluorophore) of reaction mixtures, just before the denaturizing step of each amplification cycle and records the cycle number at which fluorescence crosses a specific threshold cycle (Ct) value. The cycle number at which the signal is first detected is correlated with the original concentration of the DNA template, while the starting copy number of amplicons is inversely proportional to the real time Ct. The plasmids, both for detection of membrane rejection ability and as standards were assayed in triplicate. Standard curves were obtained by plotting the Ct value of each 10-fold dilution series of plasmids [1,2].

Publication language English
Pages 320
Journal Journal of Membrane Science
Volume 451
Publication status Published - 01.02.2014

ASJC Scopus subject areas

Biochemistry
General Materials Science
Physical and Theoretical Chemistry
Filtration and Separation